Biology mural at James Madison University

  • Biology Mural
    for James Madison University
  • I recently completed a three-story mural for the new Biology building at James Madison University.  I drew about 20 organisms to surround the large strand of DNA, which is based on a 3-D model rendered in Chimera.
    The mural spans three panels
    3rd floor, 24’8″w x 10’9″h
    2nd floor, 24’4″w x 10’8″h
    1st floor, 14’8″w x 10’7″h
    My design was printed onto adhesive panels and installed on the wall. When the mural is seen through the 3-story glass exterior wall of the building, the panels will appear to connect as one image. Close-ups of some drawings, as well as in-situ views shown below.

    Building photos by Jon Monroe
    ’m>

  • The DNA image was based on the sequence CTCCCTTTGGATGGTCTGTGGATTGACATGAATGAGTTAT
    CAAATTTCATAACTTCGCGT