- Biology Mural
for James Madison University - I recently completed a three-story mural for the new Biology building at James Madison University. I drew about 20 organisms to surround the large strand of DNA, which is based on a 3-D model rendered in Chimera.
The mural spans three panels
3rd floor, 24’8″w x 10’9″h
2nd floor, 24’4″w x 10’8″h
1st floor, 14’8″w x 10’7″h
My design was printed onto adhesive panels and installed on the wall. When the mural is seen through the 3-story glass exterior wall of the building, the panels will appear to connect as one image. Close-ups of some drawings, as well as in-situ views shown below.
Building photos by Jon Monroe 







The DNA image was based on the sequence CTCCCTTTGGATGGTCTGTGGATTGACATGAATGAGTTAT
CAAATTTCATAACTTCGCGT, generated by 3D-DART (van Dijk and Bonvin, 2009, Nuc Acids Res. 37: W235-9), and a 3-dimensional model rendered using the UCSF Chimera package from the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco, with support from the National Institutes of Health(National Center for Research Resources grant 2P41RR001081, National Institute of General Medical Sciences grant 9P41GM103311). "UCSF Chimera--a visualization system for exploratory research and analysis." Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. J Comput Chem. 2004 Oct;25(13):1605-12.

Discuss This Project: ( Comments)